Central dogma lab: DNA to mRNA to protein, and what a mutation does

What it does

The central dogma is the one-way flow of information in a cell: DNA → mRNA → protein. A gene’s DNA is copied into messenger RNA (transcription), and a ribosome reads the mRNA three bases at a time, each codon naming one amino acid (translation). This lab lays it out codon by codon:

• the coding strand of DNA (5′ to 3′), the one that reads like the mRNA;
• the template strand underneath (3′ to 5′), which the RNA is actually copied from;
• the mRNA, with U in place of T;
• the amino acid for each codon, from the first AUG (start) to a stop codon.

Then you can mutate the gene. Tap a base to change it, insert a base before it, or delete it, and the page tells you what kind of mutation it is and draws the protein chain before and after, with changed amino acids marked. It fits Class 12 Biology: molecular basis of inheritance (transcription, the genetic code, translation, mutations and frameshifts). Before this, see how genes are passed on in mendel's pea garden and where DNA sits in the cell explorer; for real sequences, use DNA sequence tools.

How to use it

1. Start with the example or type your own coding strand. The page reads from the first ATG; bases before it and after the stop are shown dashed, as they are not read.
2. Pick what a tap does: Change (to the new base you choose; if the base is already that letter, it moves to the next one), Insert before or Delete.
3. Tap a base in the strip. Changed and inserted bases are marked. Keep tapping to stack several changes; Undo all changes goes back.
4. Read the result: the big line names the kind of change, the chains show the protein before and after, and the facts list both proteins in three-letter codes.
5. Play translation steps a highlight along the codons, as a ribosome would.
6. The genetic code table opens below, and Check yourself gives fresh questions every time.

Kinds of mutation

• Silent: the codon changes but still codes for the same amino acid (often a change in the third base).
• Missense: one amino acid is swapped for another.
• Nonsense: a codon turns into a stop (UAA, UAG or UGA), so the protein is cut short.
• Frameshift: inserting or deleting one or two bases moves the reading frame, so every codon after it changes.
• In-frame: three bases (or six, nine…) added or removed: whole amino acids are gained or lost, the rest stays.

Worked example

The example coding strand GCATGGCTTGGAAAGGTCTGTTCCACTAAGCA reads from ATG: AUG GCU UGG AAA GGU CUG UUC CAC UAA, giving Met-Ala-Trp-Lys-Gly-Leu-Phe-His and stop. Change the T of TGG to C: CGG codes for arginine, so the page says Missense: one amino acid changed (Trp → Arg at amino acid 3). Change the last G of TGG to A instead: UGA is a stop, so it says Nonsense and the chain is just Met-Ala. Insert one base in the middle and the chain changes after that point: a frameshift.

FAQ

Why is the template strand written under the coding strand? Each template base pairs with the coding base above it (A with T, G with C). RNA polymerase reads the template, so the mRNA comes out matching the coding strand, with U for T.

Why do three deletions do less harm than one? Three bases are one codon, so the frame stays the same and only one amino acid is lost.

Is every silent change harmless? Usually, but not always: some change how fast or how much protein is made. The page only looks at the amino acids.

Last updated 2026-11-09.