What it does
A primer that folds on itself, sticks to its partner or binds in the wrong place wastes a PCR run. This page checks a primer or a pair against the usual design rules, entirely in your browser:
- Basics: length, GC % and the number of G or C bases among the last five at the 3′ end (the “GC clamp”).
- Melting temperature (Tm) by three simple formulas: the basic GC formula (used for the summary), a sodium-adjusted GC formula, and the Wallace rule for short oligos. All three ignore the order of the bases, so treat them as estimates.
- Runs and repeats: the longest run of one base and the longest dinucleotide repeat (such as ATATAT).
- Hairpins: the longest stem of paired bases that closes a loop of at least three.
- Primer-dimers: for each primer with itself and for the pair, the longest stretch of complementary bases, and how much of it sits at a 3′ end, where the polymerase can extend it. The worst one is drawn.
- Template: paste the target DNA to see where each primer binds (both strands, with up to two mismatches but a matching 3′ end), the products and their sizes, and any extra sites.
How to use it
- Primers. Type or paste each one 5′ to 3′, exactly as you would order it. The reverse primer is optional.
- Sodium. Only the salt-adjusted Tm uses it; 50 mM is a common PCR buffer value.
- Template. Optional: paste the sequence (FASTA headers are skipped), choose how many mismatches to allow and the largest product to report.
- Read the checks. Anything outside the usual ranges is marked “(check)” and listed at the top.
Worked example
The made-up example pair is ACTCACATCGGTGTCACCTG and TACTTCACGGCGTGTGCATC. Both are 20 nt with 55 % GC, so the basic formula gives 53.8 °C for each (62 °C by the Wallace rule, 48.7 °C salt-adjusted at 50 mM). Each ends with 3 G or C in its last five bases, has no run longer than 2, a hairpin stem of only 3 bp, and dimers of at most 4 bp with no more than 2 at a 3′ end. On the 1,500-base made-up template the forward primer binds at 201–220 and the reverse at 901–920 on the other strand, giving one 720 bp product: “Pair looks good: Tm 53.8 / 53.8 °C, 720 bp product”.
Good to know
- Formula Tm values differ from nearest-neighbour calculators by several degrees. For the annealing temperature, use your polymerase supplier’s calculator, then fine-tune with a gradient.
- A dimer that ends at a 3′ end matters far more than one in the middle.
- The template search is exact apart from the mismatches you allow; it does not search a whole genome.
FAQ
Why is my reverse primer not found? Type it 5′ to 3′ as ordered; the tool looks for its reverse complement on the top strand itself.
Can I check degenerate primers? Not yet: only A, C, G and T.
Is my sequence uploaded? No. Everything runs in your browser.
Where the numbers come from
- Tm by the Wallace rule (2 °C per A/T, 4 °C per G/C), the basic formula 64.9 + 41 × (G+C − 16.4) ÷ N and the sodium-adjusted formula 81.5 + 16.6 log₁₀[Na⁺] + 0.41 × %GC − 675 ÷ N: textbook formulas, checked against Biopython 1.88 MeltingTemp. No nearest-neighbour parameter tables are used.
- Hairpin, dimer, run and clamp checks and template search written by fibub, checked in the tests against an independent brute-force Python search. The ranges are common rules of thumb, not a standard.
- The example primers and template are random made-up sequence.
Standard scientific values, such as constants, atomic weights and melting points, are facts found in every textbook; we name where ours were checked. If you are an author or publisher and want a value, a credit or a table changed or removed, tell us and we will act quickly.
Last updated 2026-11-09.